sc:d136

Ensembl ID:
ENSDARG00000077745
ZFIN ID:
ZDB-GENE-080303-1
Description:
hypothetical protein LOC100003913 [Source:RefSeq peptide;Acc:NP_001091733]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22707 Nonsense Available for shipment Available now
sa7237 Nonsense Mutation detected in F1 DNA During 2017
sa22708 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22707
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110993 Nonsense 11 273 1 4
Genomic Location (Zv9):
Chromosome 15 (position 36635019)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38035023
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTAGAGTTCAGGCTAGTATGGGTGGACAGACAGGACTCTTTCTCTTTT[G/A]GCTTCACGGTATGATTTTAAAACATTCATTAGTGTTTTATAGTGCAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110993 Nonsense 128 273 2 4
Genomic Location (Zv9):
Chromosome 15 (position 36635955)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38035959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCCGTATTGCTTCAGRGTGGAATTAGAAACAGCTCCARAAGACAAGTW[C/G]TCTTTTGYGGAWAACTGTGTGTCAATTAAWATGATTGGTAAGTGTGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22708
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110993 Essential Splice Site 140 273 2 4
Genomic Location (Zv9):
Chromosome 15 (position 36635993)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38035997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGACAAGTACTCTTTTGCGGAAAACTGTGTGTCAATTAATATGATTG[G/A]TAAGTGTGCTTGATCTGTTGTAAAAACATTTTTTTAATGCTTGCAAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link