si:dkey-189i22.3

Ensembl ID:
ENSDARG00000077740
ZFIN ID:
ZDB-GENE-091204-128
Human Orthologue:
B3GALTL
Human Description:
beta 1,3-galactosyltransferase-like [Source:HGNC Symbol;Acc:20207]
Mouse Orthologue:
B3galtl
Mouse Description:
beta 1,3-galactosyltransferase-like Gene [Source:MGI Symbol;Acc:MGI:2685903]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27637 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27637
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109563 Essential Splice Site 210 310 6 8
ENSDART00000124348   None 125 None 4
ENSDART00000138542 Essential Splice Site 367 467 11 13

The following transcripts of ENSDARG00000077740 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 34726819)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 33754677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTATGGGCTTAGCAGGGATGGCTACAGCTACATCACAGGAGGTGGAGGG[T/C]AAGCTATGAATATGATGTGCTCAGATATTGCAATTGCTCATAATTGCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link