si:ch211-202h22.6

Ensembl ID:
ENSDARG00000077721
ZFIN ID:
ZDB-GENE-090313-76
Description:
Novel protein similar to vertebrate Testis-specific gene 118 protein (TSG118) [Source:UniProtKB/TrEM
Human Orthologue:
C16orf88
Human Description:
chromosome 16 open reading frame 88 [Source:HGNC Symbol;Acc:34404]
Mouse Orthologue:
2310008H09Rik
Mouse Description:
RIKEN cDNA 2310008H09 gene Gene [Source:MGI Symbol;Acc:MGI:1913606]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7413 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077578 Missense 430 451 6 6
ENSDART00000132785 Missense 454 475 6 6
ENSDART00000146677   None 209 None 3
Genomic Location (Zv9):
Chromosome 1 (position 55233065)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54016004
KASP Assay ID:
554-4293.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAACCGCCACAYGGACTTCAGGAATAAAGGAGCCGGGTTGGGCTTCAG[T/A]GCGCCGTCCAATAAGAAGTTTGCGAKTGATACTAATGCACGAAACTCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link