GRIK3

Ensembl ID:
ENSDARG00000077715
Description:
glutamate receptor, ionotropic, kainate 3 [Source:HGNC Symbol;Acc:4581]
Human Orthologue:
GRIK3
Human Description:
glutamate receptor, ionotropic, kainate 3 [Source:HGNC Symbol;Acc:4581]
Mouse Orthologue:
Grik3
Mouse Description:
glutamate receptor, ionotropic, kainate 3 Gene [Source:MGI Symbol;Acc:MGI:95816]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36024 Nonsense Mutation detected in F1 DNA During 2017
sa28568 Nonsense Mutation detected in F1 DNA During 2017
sa36023 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111823 Nonsense 474 991 10 16
Genomic Location (Zv9):
Chromosome 16 (position 4466038)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 3623950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGCATAGACCTGCTTAAGGAGTTGGCCAGCATTCTAGGTTTCTCCTA[C/A]GAAATCCACCTGGTGCCAGACGGAAAGTATGGCTTTCAAGATGACAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28568
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111823 Nonsense 661 991 13 16
Genomic Location (Zv9):
Chromosome 16 (position 4423640)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 3581552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTACACAGCCAACCTGGCAGCCTTCCTCACCGTGGAGAGGATGGATT[C/A]GCCCGTGGACTCGGCCGATGACCTGGCCAAACAGACCAAAATAGAGTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111823 Nonsense 672 991 13 16
Genomic Location (Zv9):
Chromosome 16 (position 4423608)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 3581520
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTGGAGAGGATGGATTCGCCCGTGGACTCGGCCGATGACCTGGCCAAA[C/T]AGACCAAAATAGAGTACGGCGTAGTCAAAGACGGAGCAACCATGTCCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link