si:ch211-218o21.3

Ensembl ID:
ENSDARG00000077709
ZFIN ID:
ZDB-GENE-081105-73
Description:
Novel protein similar to vertebrate IQ motif and Sec7 domain 1 (IQSEC1) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
IQSEC2
Human Description:
IQ motif and Sec7 domain 2 [Source:HGNC Symbol;Acc:29059]
Mouse Orthologue:
Iqsec2
Mouse Description:
IQ motif and Sec7 domain 2 Gene [Source:MGI Symbol;Acc:MGI:3528396]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34453 Nonsense Mutation detected in F1 DNA During 2017
sa14795 Essential Splice Site Available for shipment Available now
sa7145 Nonsense Mutation detected in F1 DNA During 2017
sa15370 Essential Splice Site Available for shipment Available now
sa38703 Nonsense Mutation detected in F1 DNA During 2017
sa15249 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111680 Nonsense 56 1276 1 12
ENSDART00000140410 Nonsense 153 1373 2 13
Genomic Location (Zv9):
Chromosome 8 (position 38060943)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36916358
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGAGAGCCGCATGACACGCCGCATCATCCTCTCCAACATGCGACTG[C/T]AGTATTCATTTGATGACCGGCATCCTCAACCACCCAACCCGACTCACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111680 Essential Splice Site 107 1276 1 12
ENSDART00000140410 Essential Splice Site 204 1373 2 13
Genomic Location (Zv9):
Chromosome 8 (position 38061099)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36916514
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTCCACGGCCAGAGTACACCCAACTGGAGGACACTTTCTCCAAACAA[G/A]TTAGTACTCAGTTGACTCTATCATAGCATGTGCTGGATKCCTTCCTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111680 Nonsense 378 1276 2 12
ENSDART00000140410 Nonsense 475 1373 3 13
Genomic Location (Zv9):
Chromosome 8 (position 38064245)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36919660
KASP Assay ID:
554-5280.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCRCTCTCATCTTCCTCRTCTGCACCACTGCCCCCTGGTGGCTTGGAG[C/T]AACAGTGCTGCTCAGATGGGGATAATGACTCTCTGAACTCCACCACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15370
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111680 Essential Splice Site 550 1276 5 12
ENSDART00000140410 Essential Splice Site 647 1373 6 13
Genomic Location (Zv9):
Chromosome 8 (position 38068313)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36923728
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATCTGCCCCTCAAATATTTGCTCTCAAATATTAYTTCTCTATTTCAC[A/C]GTCAGAGGTATTGCRTTTRTAATCCAGCACTGGTAAGACAGTTCCAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38703
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111680 Nonsense 660 1276 7 12
ENSDART00000140410 Nonsense 757 1373 8 13
Genomic Location (Zv9):
Chromosome 8 (position 38071821)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36927236
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGTAAATACCTTTTCTTTGATTAAAGGTTTTGTCTCTGCCTCACCGG[A/T]GACTGGTGTGCTGCTGTCAGCTCCATGAAGTCCCGGACCCTAATCGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15249
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111680 Nonsense 833 1276 10 12
ENSDART00000140410 Nonsense 930 1373 11 13
Genomic Location (Zv9):
Chromosome 8 (position 38076359)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36931774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATGGGAAGGCCTAGTCTGGATGACARCTATTCACCRGGAGAAGGCCTT[A/T]AACGTACTGCTCTCAGCTCCTCACTGAGGGACCTGTCTGAATCAGGTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link