A5PF17_DANRE

Ensembl ID:
ENSDARG00000077696
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5PF17]
Human Orthologue:
FAM188B
Human Description:
family with sequence similarity 188, member B [Source:HGNC Symbol;Acc:21916]
Mouse Orthologue:
Fam188b
Mouse Description:
family with sequence similarity 188, member B Gene [Source:MGI Symbol;Acc:MGI:3583959]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27164 Essential Splice Site Mutation detected in F1 DNA During 2015
sa21251 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa27164
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114194 Essential Splice Site 652 752 16 19
Genomic Location:
Chromosome 8 (position 19026411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTGATATTGGGCTGCTCTCTTTATTTGAGCACTATAATATATGCAAG[G/A]TAATAAATAATAATACTTGGAAAAAAAATCTAAATGTTTCTATATTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114194 Essential Splice Site 652 752 16 19
Genomic Location:
Chromosome 8 (position 19026410)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGATATTGGGCTGCTCTCTTTATTTGAGCACTATAATATATGCAAGG[T/C]AATAAATAATAATACTTGGAAAAAAAATCTAAATGTTTCTATATTTCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Nephrolithiasis: A genome-wide association study of nephrolithiasis in the Japanese population identifies novel susceptible Loci at 5q35.3, 7p14.3, and 13q14.1. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/suru6yq5