LOC563292

Ensembl ID:
ENSDARG00000077693
Human Orthologue:
ZNF639
Human Description:
zinc finger protein 639 [Source:HGNC Symbol;Acc:30950]
Mouse Orthologue:
Zfp639
Mouse Description:
zinc finger protein 639 Gene [Source:MGI Symbol;Acc:MGI:1915028]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30362 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112252 Nonsense 484 583 7 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3516 (position 12274)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149681.1 12274
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACACTCCGCCTCGCACAAAGCCAAGAAAATGCACCAGTGCCGCCACTG[C/A]AACTTTAAAATTTCGGATCCGTTCGTACTCAGTCGCCATATCTTATCCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link