si:ch211-221p4.4

Ensembl ID:
ENSDARG00000077691
ZFIN ID:
ZDB-GENE-030131-4628
Description:
solute carrier family 13, member 5 [Source:RefSeq peptide;Acc:NP_001136038]
Human Orthologue:
SLC13A5
Human Description:
solute carrier family 13 (sodium-dependent citrate transporter), member 5 [Source:HGNC Symbol;Acc:23
Mouse Orthologue:
Slc13a5
Mouse Description:
solute carrier family 13 (sodium-dependent citrate transporter), member 5 Gene [Source:MGI Symbol;Ac

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13652 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111177 Nonsense 122 582 3 12
ENSDART00000141160 Nonsense 76 532 3 12

The following transcripts of ENSDARG00000077691 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 38914608)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40054673
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAATCTGCACAAGCGGATCGCCCTGCGGGKGCTGCTCMTTGTGGGKGTT[C/T]GACCAGCTCTGTAAGCATTTAAGAATTCATTAAGAAGCTTYTTGAACAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link