cpo

Ensembl ID:
ENSDARG00000077688
ZFIN ID:
ZDB-GENE-070619-6
Description:
hypothetical protein LOC100005630 [Source:RefSeq peptide;Acc:NP_001139101]
Human Orthologue:
CPO
Human Description:
carboxypeptidase O [Source:HGNC Symbol;Acc:21011]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4827 Nonsense Mutation detected in F1 DNA During 2014
sa1190 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa4827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109756 Nonsense 61 363 3 9
Genomic Location:
Chromosome 1 (position 4467466)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAATCAGATGCAAAGGGAAAACCCAGATGTYGTGTCCACCATGAYATA[T/A]GGACAAACATATGAGAAGAGGAACATTACATTACTAAAGGTATTTAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1190
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109756 Essential Splice Site 247 363 7 9
Genomic Location:
Chromosome 1 (position 4473349)
KASP Assay ID:
554-1099.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCCCCTACGGACACCCCAACATCTCTGCGCCCAATTACGACGAGCTGG[T/A]AAGCAGAAGAGAAAGCTTTTTTTGGAGGATATGTTAGCATCTCGGGAGCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vx2d2etn