PDGFD

Ensembl ID:
ENSDARG00000077677
Description:
platelet derived growth factor D [Source:HGNC Symbol;Acc:30620]
Human Orthologue:
PDGFD
Human Description:
platelet derived growth factor D [Source:HGNC Symbol;Acc:30620]
Mouse Orthologue:
Pdgfd
Mouse Description:
platelet-derived growth factor, D polypeptide Gene [Source:MGI Symbol;Acc:MGI:1919035]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22727 Essential Splice Site Available for shipment Available now
sa24998 Nonsense Mutation detected in F1 DNA During 2017
sa42627 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22727
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111373 Essential Splice Site 54 372 1 7
Genomic Location (Zv9):
Chromosome 15 (position 43740747)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 44910117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTGATGTCCTCCAGAGTCATGAGGGCTTCAAACATACGCAGCAATGG[T/A]GAGTTTGAACGATAAAGTGATTTAAAAAAATGCTAGGATGAGTGACAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111373 Nonsense 106 372 2 7
Genomic Location (Zv9):
Chromosome 15 (position 43846895)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 44939502
KASP Assay ID:
554-7502.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGTCGCCGCCGCACACACGCATCCTGCTGGAGTTTGATGCTCAGTTT[G/T]GACTGGAAGAGGCCGAGAATGGAGTCTGCAGGTGAGGGCGGAGCTTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111373 Nonsense 366 372 7 7
Genomic Location (Zv9):
Chromosome 15 (position 43880763)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 44973370
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTGGAGGAGATTTACCTGCAGCATCACGAGAGATGTGACTGTGTGTG[T/A]CAATCCAGACCACCACGATAAACACACACACACTAGAGTCCAAACCACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary heart disease: A genome-wide association study in Europeans and South Asians identifies five new loci for coronary artery disease. (View Study)
  • Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)
  • Platelet counts: Duffy-null-associated low neutrophil counts influence HIV-1 susceptibility in high-risk South African black women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link