si:ch211-191a16.3

Ensembl ID:
ENSDARG00000077673
ZFIN ID:
ZDB-GENE-081028-40
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15562 Nonsense Available for shipment Available now
sa28530 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099821 Nonsense 2 868 1 9
ENSDART00000146246 Nonsense 152 487 6 6
Genomic Location (Zv9):
Chromosome 15 (position 40452558)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41969265
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATATATTTTCAACAGACAGGATTCCGAAACCCATAGACAAAAAATCCAA[A/T]GATTYAAATCAAACATAARAMAGAAACATCAGTACATTTTTGAAGGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099821 Nonsense 180 868 1 9
ENSDART00000146246 Nonsense 330 487 6 6
Genomic Location (Zv9):
Chromosome 15 (position 40453092)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41969799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTGATGGTTTGGATGAATGTCGGCTTCCCTTAAATTTCAGAAGGAAC[G/T]AGACTCTGAGGGATGCAAACAAAGAGACATCAGTGGATGTGCTGCTGACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link