si:ch1073-210b3.2

Ensembl ID:
ENSDARG00000077661
ZFIN ID:
ZDB-GENE-081104-77
Description:
Novel protein similar to H.sapiens LRRC16A, leucine rich repeat containing 16A (LRRC16A) [Source:Uni
Human Orthologue:
LRRC16A
Human Description:
leucine rich repeat containing 16A [Source:HGNC Symbol;Acc:21581]
Mouse Orthologue:
Lrrc16a
Mouse Description:
leucine rich repeat containing 16A Gene [Source:MGI Symbol;Acc:MGI:1915982]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36739 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36739
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111501 Essential Splice Site 12 61 2 3
ENSDART00000136542   None 50 None 2
ENSDART00000141918 Essential Splice Site 57 106 3 4
Genomic Location (Zv9):
Chromosome 19 (position 139315)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 164472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTATGTGTGTGTGTGTGTGTTTCACCGCTGTGTGTTTGTGTTTGAA[G/A]GACGTGGACACCATCTATCTGTCTCAGGACACCAAAGAGCTCTGCCTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Iron status biomarkers: Variants in TF and HFE explain approximately 40% of genetic variation in serum-transferrin levels. (View Study)
  • Mean platelet volume: A meta-analysis and genome-wide association study of platelet count and mean platelet volume in african americans. (View Study)
  • Uric acid levels: Meta-analysis of 28,141 individuals identifies common variants within five new loci that influence uric acid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link