si:ch211-71k24.5

Ensembl ID:
ENSDARG00000077656
ZFIN ID:
ZDB-GENE-081107-37
Description:
Novel protein similar to vertebrate brefeldin A-inhibited guanine nucleotide-exchange protein 3 (KIA
Human Orthologue:
KIAA1244
Human Description:
KIAA1244 [Source:HGNC Symbol;Acc:21213]
Mouse Orthologue:
D10Bwg1379e
Mouse Description:
DNA segment, Chr 10, Brigham & Women's Genetics 1379 expressed Gene [Source:MGI Symbol;Acc:MGI:10638

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42119 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22200 Nonsense Available for shipment Available now
sa16643 Essential Splice Site, Missense Available for shipment Available now
sa13753 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114456 Essential Splice Site 141 1717 None 32
ENSDART00000137124   None 1352 None 23
ENSDART00000146355 Essential Splice Site 136 176 None 6
Genomic Location (Zv9):
Chromosome 13 (position 2233155)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2200819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAAGATTTGTCATTAGGATTTGCTGAAAATCTGTGTTGTTGTTTCTCT[A/T]GGTATGTATAGAGACGTATATATCCAGTTGTCATCAGCGCAGTATCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114456 Nonsense 482 1717 12 32
ENSDART00000137124 Nonsense 254 1352 4 23
ENSDART00000146355   None 176 None 6
Genomic Location (Zv9):
Chromosome 13 (position 2240610)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2193364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGAGTCAATGCGTGAGTCTGTGGAAGTCAACGAAGCGGACTTCCGCTG[G/A]CAGCGGCGAGTGCTCTCATCCGAAAACGCTGCATGGGAGGCGAGCATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114456 Missense 509 1717 12 32
ENSDART00000137124 Essential Splice Site 280 1352 4 23
ENSDART00000146355   None 176 None 6
Genomic Location (Zv9):
Chromosome 13 (position 2240689)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2193285
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCATGGGAGGCGRGCATTACCGAACGCAGCCCTGAMATTAGCATTAGC[G/A]TCACCACCGACACAGGCCAGACCACTTTGGAAGGGGATGTAGGGCAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13753
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114456 Nonsense 1251 1717 22 32
ENSDART00000137124 Nonsense 974 1352 15 23
ENSDART00000146355   None 176 None 6
Genomic Location (Zv9):
Chromosome 13 (position 2258289)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 2175685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCCGTGTCCTTCATCCATGATGTCCTGATGGAGGTTTTGAGCAGCTG[G/A]CCGGAGCTGCCGCATTTTCACTTCAATGAGGCTCTTTTCAGRCCGTTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link