LOC792371

Ensembl ID:
ENSDARG00000077654
Human Orthologue:
GRM8
Human Description:
glutamate receptor, metabotropic 8 [Source:HGNC Symbol;Acc:4600]
Mouse Orthologue:
Grm8
Mouse Description:
glutamate receptor, metabotropic 8 Gene [Source:MGI Symbol;Acc:MGI:1351345]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40206 Nonsense Mutation detected in F1 DNA During 2016
sa33363 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33364 Nonsense Mutation detected in F1 DNA During 2016
sa7554 Missense Mutation detected in F1 DNA During 2016
sa8697 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109044 Nonsense 409 909 6 10
Genomic Location (Zv9):
Chromosome 4 (position 3546469)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3662171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAGTTATGAGCAGGAAGGAAAGGTTCAGTTCGTGATGGATGCAGTGTA[T/A]GCGATGGCTCACGCTCTCCACCGAATGCACAGGGAATACTGCTTCGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109044 Essential Splice Site 498 909 7 10
Genomic Location (Zv9):
Chromosome 4 (position 3570903)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3686605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTGAGTACAAAGTGATCGGCCAGTGGACAAACAAACTGCATCTAAAC[G/T]TGAGTAAAAGAGATTTTCCTGCTCGTCCATGCATTCAGGGGTTTTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33364
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109044 Nonsense 526 909 8 10
Genomic Location (Zv9):
Chromosome 4 (position 3578298)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3694000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGACTTCCAGCTTCAGTGTGCAGTGTGCCATGTCAAATGGGTGAACGT[A/T]AGAAGATCGTGAAGGGTGTGCCCTGCTGCTGGCATTGTGAGCGGTGCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7554
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109044 Missense 541 909 8 10
Genomic Location (Zv9):
Chromosome 4 (position 3578343)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3694045
KASP Assay ID:
554-4206.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGTAAGAAGATYGTGAAGGGTGTGCCCTGCTGCTGGCATTRTGAGCGG[T/A]GCGAAGGCTACCACTTCCAGGCCAGCGAGTTCAGCTGCGAACTCTGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8697
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109044 Essential Splice Site 810 909 8 10
ENSDART00000109044 Essential Splice Site 810 909 8 10
Genomic Location (Zv9):
Chromosome 4 (position 3579154)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3694856
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTAGCTTTTATACCAATCTTCTTTGGCACTGCACAATCGGCGGAAAGGG[T/C]AAGTGTGATTTAAGAAATTCCTTAATGAAATAYACTGAATTTAATGCYAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link