ENSDARG00000077651

Ensembl ID:
ENSDARG00000077651
Mouse Orthologues:
Gm4070, Gvin1
Mouse Descriptions:
GTPase, very large interferon inducible 1 Gene [Source:MGI Symbol;Acc:MGI:1921808]
predicted gene 4070 Gene [Source:MGI Symbol;Acc:MGI:3782245]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30829 Nonsense Mutation detected in F1 DNA During 2015
sa1892 Nonsense F2 line generated During 2015
sa7549 Missense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa30829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111519 Nonsense 206 2306 2 5
Genomic Location:
Chromosome 3 (position 8041085)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGAAAGTAGTAAAACGAGCATTACTTGCTGCAGCAATAACCGGAGGAT[C/A]AGGATTAGCAGCACTGGGTATATTTAAAGCAGCAACAGGCCTAGCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1892
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111519 Nonsense 1892 2306 5 5
Genomic Location:
Chromosome 3 (position 8015133)
KASP Assay ID:
554-1882.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGAAGAGAGTAACAGAACATCAAAATGGATCAGTGAAATATGTGTTC[A/T]AGAATGAATTCTTCATGGATTTGATATTCTCTATCATTCAAAAAGCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7549
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111519 Missense 2237 2306 5 5
Genomic Location:
Chromosome 3 (position 8014098)
KASP Assay ID:
554-4153.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCATATAAAGAATACAGAAAAGCAGGAGGACTTTATGCAAAGTGGAGC[A/T]TCACTACTGACCACTCTGAACTGCCCTACTGGAAGTGGTTTGTGTGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zb4vhmj7