ENSDARG00000077651

Ensembl ID:
ENSDARG00000077651
Mouse Orthologues:
Gm4070, Gvin1
Mouse Descriptions:
GTPase, very large interferon inducible 1 Gene [Source:MGI Symbol;Acc:MGI:1921808]
predicted gene 4070 Gene [Source:MGI Symbol;Acc:MGI:3782245]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1892 Nonsense F2 line generated During 2014
sa7549 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1892
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111519 Nonsense 1892 2306 5 5
Genomic Location:
Chromosome 3 (position 8015133)
KASP Assay ID:
554-1882.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGAAGAGAGTAACAGAACATCAAAATGGATCAGTGAAATATGTGTTC[A/T]AGAATGAATTCTTCATGGATTTGATATTCTCTATCATTCAAAAAGCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7549
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111519 Missense 2237 2306 5 5
Genomic Location:
Chromosome 3 (position 8014098)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCATATAAAGAATACAGAAAAGCAGGAGGACTTTATGCAAAGTGGAGC[A/T]TCACTACTGACCACTCTGAACTGCCCTACTGGAAGTGGTTTGTGTGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zb4vhmj7