tnks

Ensembl ID:
ENSDARG00000077650
Human Orthologue:
TNKS
Human Description:
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase [Source:HGNC Symbol;Acc:11941]
Mouse Orthologue:
Tnks
Mouse Description:
tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase Gene [Source:MGI Symbol;Acc:MGI:13

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18265 Essential Splice Site Available for shipment Available now
sa16785 Essential Splice Site Available for shipment Available now
sa8904 Nonsense Mutation detected in F1 DNA During 2014
sa25154 Essential Splice Site Mutation detected in F1 DNA During 2014
sa25155 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18265
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111694 Essential Splice Site 277 1280 3 28
ENSDART00000132653 Essential Splice Site 256 1252 3 27

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 21 (position 18773611)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTCTGCCCTGGACCTGGCCGACCCGTCCGCGAAAGCTGTCCTCACAG[G/A]YAAGTGCCACATTYTGTSTTTTATCAGTGTTTTGATCTTCAGCTGAACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16785
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111694 Essential Splice Site 278 1280 None 28
ENSDART00000132653 Essential Splice Site 257 1252 None 27
Genomic Location:
Chromosome 21 (position 18773612)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTCTGCCCTGGACCTGGCCGACCCGTCCGCGAAAGCTGTCCTCACAGR[T/C]AAGTGCCACATTYTGTSTTTTATCAGTGTTTTGATCTTCAGCTGAACGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111694 Nonsense 490 1280 11 28
ENSDART00000132653 Nonsense 462 1252 10 27
Genomic Location:
Chromosome 21 (position 18870287)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCTCTGTCCTGTATTTCAGCACTGTGCKGTCGTTTCACCTCACCCAAAA[C/T]GAAAACAGGTCACTGAACTGCTGCTGCGGAAAGGAGCCAATGTCAATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111694 Essential Splice Site 537 1280 13 28
ENSDART00000132653 Essential Splice Site 509 1252 12 27
Genomic Location:
Chromosome 21 (position 18892540)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTCAGACTGCTTACTTCCTTCTCCATCTCTTTTGTTTGTTTGTTTGT[A/T]GATGAATGCTGTTGACACACTGGGTCAGACGGCTTTGCACCGGGCGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25155
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111694 Essential Splice Site 537 1280 13 28
ENSDART00000132653 Essential Splice Site 509 1252 12 27
Genomic Location:
Chromosome 21 (position 18892541)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCAGACTGCTTACTTCCTTCTCCATCTCTTTTGTTTGTTTGTTTGTA[G/T]ATGAATGCTGTTGACACACTGGGTCAGACGGCTTTGCACCGGGCGGCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ct9l7r85