si:ch211-42i9.8

Ensembl ID:
ENSDARG00000077648
ZFIN ID:
ZDB-GENE-090312-31
Description:
folliculin interacting protein 2 [Source:RefSeq peptide;Acc:NP_001139090]
Human Orthologues:
FNIP1, FNIP2
Human Descriptions:
folliculin interacting protein 1 [Source:HGNC Symbol;Acc:29418]
folliculin interacting protein 2 [Source:HGNC Symbol;Acc:29280]
Mouse Orthologues:
Fnip1, Fnip2
Mouse Descriptions:
folliculin interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:2444668]
folliculin interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:2683054]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10994 Essential Splice Site Available for shipment Available now
sa15502 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10994
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112490 Essential Splice Site 352 1083 13 30
ENSDART00000138276 Essential Splice Site 348 897 11 19
Genomic Location (Zv9):
Chromosome 1 (position 18530186)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19095354
KASP Assay ID:
2259-0449.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTCTTTTCGAGTCTCACATGAACAAACTCAAGACTGCCATCGAGAGGG[T/C]GAGTKTGAAAGCGCAGGACAGTGATTTATTATAGCAGCCTTTGTAGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112490 Nonsense 609 1083 17 30
ENSDART00000138276 Nonsense 605 897 15 19
Genomic Location (Zv9):
Chromosome 1 (position 18538124)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 19103292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACCAATACACCYACYGGTCTAGAAGCGAGCAYGGTCAGGCCTGAATG[T/A]ACTGAAATGGGACCGGAATGTTTTGGAGAACACGTCGACTCTGTTGGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link