ENSDARG00000077644

Ensembl ID:
ENSDARG00000077644
Human Orthologues:
LPAR4, LPAR6
Human Descriptions:
lysophosphatidic acid receptor 4 [Source:HGNC Symbol;Acc:4478]
lysophosphatidic acid receptor 6 [Source:HGNC Symbol;Acc:15520]
Mouse Orthologues:
Lpar4, Lpar6
Mouse Descriptions:
lysophosphatidic acid receptor 4 Gene [Source:MGI Symbol;Acc:MGI:1925384]
lysophosphatidic acid receptor 6 Gene [Source:MGI Symbol;Acc:MGI:1914418]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20946 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113983 Nonsense 234 308 1 2
Genomic Location:
Chromosome 7 (position 27571913)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTAAATAAAAGCACAGCAGCTCAGACCAGTGAACTTGTAGACAGCGGA[C/T]GAATTAAAAGGATGATAATAACTAACCTGGCGATCTTTCTGCTTTGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8q03bqqq