lypd6b

Ensembl ID:
ENSDARG00000077643
ZFIN ID:
ZDB-GENE-050522-38
Description:
hypothetical protein LOC554606 [Source:RefSeq peptide;Acc:NP_001121801]
Human Orthologue:
LYPD6B
Human Description:
LY6/PLAUR domain containing 6B [Source:HGNC Symbol;Acc:27018]
Mouse Orthologue:
Lypd6b
Mouse Description:
LY6/PLAUR domain containing 6B Gene [Source:MGI Symbol;Acc:MGI:1919147]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41411 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105623 Essential Splice Site 33 165 1 4
ENSDART00000135461 Essential Splice Site 58 190 4 7

The following transcripts of ENSDARG00000077643 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24180242)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23336028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTAACAAGTGAGAACATTGATTTCTACAATCTCAGGCCAGCTATAGAAG[G/T]TGGGTGTGTTTATTTCAGTCAAATGAGTCATTTTATTTGAATGTACACTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link