thbs3a

Ensembl ID:
ENSDARG00000077641
ZFIN ID:
ZDB-GENE-020708-3
Description:
Thrombospondin-3a [Source:UniProtKB/Swiss-Prot;Acc:Q8JHW2]
Human Orthologue:
THBS3
Human Description:
thrombospondin 3 [Source:HGNC Symbol;Acc:11787]
Mouse Orthologue:
Thbs3
Mouse Description:
thrombospondin 3 Gene [Source:MGI Symbol;Acc:MGI:98739]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6444 Nonsense Mutation detected in F1 DNA During 2014
sa17435 Nonsense Available for shipment Available now
sa10527 Essential Splice Site Available for shipment Available now
sa22930 Nonsense Mutation detected in F1 DNA During 2014
sa9297 Nonsense Mutation detected in F1 DNA During 2014
sa10346 Nonsense Available for shipment Available now
sa17001 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057305 Nonsense 27 962 1 23
Genomic Location:
Chromosome 16 (position 45771219)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTCTGGTCGTGTTGATGTYCGTCTGGKCAGCACAGAGCGACAAGAAA[C/T]AAGACGTGCCAGGTAWTTTTTCTCTCTTTCTAAACTTCGAGTAATGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057305 Nonsense 344 962 9 23
Genomic Location:
Chromosome 16 (position 45758430)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGTGTTATACACCGGGTGCTTGTGTCAATACTGCAAGAGGTTTTACCTG[T/A]GAGTCRTGTCCCCCTGGCATGTGGGGTCCRCCTTTGTCTGGAGTSGGWGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10527
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057305 Essential Splice Site 572 962 15 23
Genomic Location:
Chromosome 16 (position 45750735)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGTTTTGTGTTTTYACAGCATCATCTTGAGTGGATGTGATGTTTTGC[A/T]GGGATTCAGAATGTTCTGGATAACTGTCCTAAAGTGCCGAACCCGATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057305 Nonsense 580 962 15 23
Genomic Location:
Chromosome 16 (position 45750708)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGAGTGGATGTGATGTTTTGCAGGGATTCAGAATGTTCTGGATAACTG[T/A]CCTAAAGTGCCGAACCCGATGCAGACGGACCGAGACAGAGACGGAGTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057305 Nonsense 814 962 20 23
ENSDART00000057305 Nonsense 814 962 20 23
Genomic Location:
Chromosome 16 (position 45744811)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTCATCTTCGGCTACCAGGATTCATCTAGTTTCTACGTGGTGATGTG[G/A]AAGCAGACCGAACAGACRTACTGGCAGTCCATCCCATTCAGAGCCATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057305 Nonsense 814 962 20 23
ENSDART00000057305 Nonsense 814 962 20 23
Genomic Location:
Chromosome 16 (position 45744811)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTCATCTTCGGCTACCAGGATTCATCTAGTTTCTACGTGGTGATGTG[G/A]AAGCAGACCGAACAGACRTACTGGCAGTCCATCCCATTCAGAGCCATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17001
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057305 Nonsense 872 962 21 23
Genomic Location:
Chromosome 16 (position 45744520)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCATGCTGGAGATACTGATGGAGAGGTGAAGCTGCTGTGGAAAGACCCA[C/T]GAAACGTCGGCTGGCTGGATAAAACATCGTATCGGTGGCAGCTCAGCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7z8czftb