si:ch211-66g24.1

Ensembl ID:
ENSDARG00000077633
ZFIN ID:
ZDB-GENE-081105-33
Description:
Novel protein similar to vertebrate membrane associated guanylate kinase, WW and PDZ domain containi
Human Orthologues:
MAGI2, MAGI3
Human Descriptions:
membrane associated guanylate kinase, WW and PDZ domain containing 2 [Source:HGNC Symbol;Acc:18957]
membrane associated guanylate kinase, WW and PDZ domain containing 3 [Source:HGNC Symbol;Acc:29647]
Mouse Orthologues:
Magi2, Magi3
Mouse Descriptions:
membrane associated guanylate kinase, WW and PDZ domain containing 2 Gene [Source:MGI Symbol;Acc:MGI
membrane associated guanylate kinase, WW and PDZ domain containing 3 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34452 Nonsense Mutation detected in F1 DNA During 2017
sa30903 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa772 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa34452
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115228 Nonsense 26 993 2 16
ENSDART00000144255 Nonsense 138 1074 3 15
Genomic Location (Zv9):
Chromosome 8 (position 37823920)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36679335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGTGTTTTCCTGTCTTCCATGTCATGGCAGGTACAACTAGACAGCCA[C/T]GAGACGGTGAGATCTCTGGGGTCGACTATAACTTTGTGTCAGTCGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115228 Splice Site, Nonsense 205 993 6 16
ENSDART00000144255 Splice Site, Nonsense 317 1074 7 15
Genomic Location (Zv9):
Chromosome 8 (position 37852209)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36707624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCATGCTGAACTCTGTCACCATCATCTTTCTGGTTTATTATTTGTAG[T/A]AGCAGAGTTTACGGACCAGCCGAGTGAACTGAGAGGTTTCTCCGTCCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa772
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115228 Nonsense 285 993 7 16
ENSDART00000144255 Nonsense 397 1074 8 15
Genomic Location (Zv9):
Chromosome 8 (position 37855298)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 36710713
KASP Assay ID:
554-0677.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATACCTGTGTGCTCGGCTACTCTCACAAAGATGTAGTAGAAATGCTA[A/T]AAGCCATCCCTATTGGTCATACTGTGGACATCATGGTCCGAAGAGGTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link