NP_001152755.1

Ensembl ID:
ENSDARG00000077630
Description:
dickkopf-related protein 3 [Source:RefSeq peptide;Acc:NP_001152755]
Human Orthologue:
DKK3
Human Description:
dickkopf homolog 3 (Xenopus laevis) [Source:HGNC Symbol;Acc:2893]
Mouse Orthologue:
Dkk3
Mouse Description:
dickkopf homolog 3 (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1354952]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30340 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111046 Nonsense 78 293 2 7
Genomic Location (Zv9):
Chromosome Zv9_scaffold3485 (position 281086)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 65264959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTCCCCTCAGATGGACAATGAGACAGCAAAATCAAGCCTTCATCCA[C/T]AGAATGTCTCTTCAAACCTCCAAAATTACAGCGCTATTGAAACCATAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link