si:ch211-263p13.7

Ensembl ID:
ENSDARG00000077622
ZFIN ID:
ZDB-GENE-091204-336
Human Orthologues:
SLC35F3, SLC35F4
Human Descriptions:
solute carrier family 35, member F3 [Source:HGNC Symbol;Acc:23616]
solute carrier family 35, member F4 [Source:HGNC Symbol;Acc:19845]
Mouse Orthologues:
Slc35f3, Slc35f4
Mouse Descriptions:
solute carrier family 35, member F3 Gene [Source:MGI Symbol;Acc:MGI:2444426]
solute carrier family 35, member F4 Gene [Source:MGI Symbol;Acc:MGI:1922538]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41674 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110501 Nonsense 298 417 5 7
ENSDART00000136122 Nonsense 207 293 4 6
Genomic Location (Zv9):
Chromosome 10 (position 27455461)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 26858255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCACACACGTGGAATACTGGCCTCCCTCTCAGCATATCCCCTGGGAC[A/T]AACTATGCGTCATGGCTTCTCTACTGCTGGGTATTTATTTTATGCTTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link