elfn2

Ensembl ID:
ENSDARG00000077609
ZFIN ID:
ZDB-GENE-080327-26
Description:
Novel protein similar to H.sapiens ELFN2, extracellular leucine-rich repeat and fibronectin type III
Human Orthologue:
ELFN2
Human Description:
extracellular leucine-rich repeat and fibronectin type III domain containing 2 [Source:HGNC Symbol;A
Mouse Orthologue:
Elfn2
Mouse Description:
leucine rich repeat and fibronectin type III, extracellular 2 Gene [Source:MGI Symbol;Acc:MGI:360841

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15928 Nonsense Available for shipment Available now
sa10305 Nonsense Available for shipment Available now
sa14520 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109769 Nonsense 100 844 1 5
ENSDART00000139892 Nonsense 114 403 1 1
Genomic Location:
Chromosome 22 (position 15154914)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTCACCAAGAATGAAATCTCCTACATTGAGGACGGTGCCTTTGCAGGA[C/T]AGGCCAATCTACAGGTCTTGCAGCTGGGATATAACAAGCTTACCAATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10305
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109769 Nonsense 193 844 1 5
ENSDART00000139892 Nonsense 207 403 1 1
Genomic Location:
Chromosome 22 (position 15154633)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGTATGCGAACTAGCTGGAAATCCTTTCCACTGTGGCTGTGACTTGTA[C/A]ACCTTTCTTATTTGGCTAGAGGCATTTGACAATGTCACTCACACATACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109769 Nonsense 809 844 5 5
ENSDART00000139892 None None 403 None 1
Genomic Location:
Chromosome 22 (position 15152560)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATMTGGGAGCGCTTCCGACCMTRCAAAAAAAGCCCCCGTGAGGAGGCATA[C/A]ATAGCCGCTGGTCATGCTCTTCGRAAGAAAGTGCAGTTTGCAAAGGATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5ptaundc