LOC100329483

Ensembl ID:
ENSDARG00000077606
Human Orthologue:
ARSI
Human Description:
arylsulfatase family, member I [Source:HGNC Symbol;Acc:32521]
Mouse Orthologue:
Arsi
Mouse Description:
arylsulfatase i Gene [Source:MGI Symbol;Acc:MGI:2670959]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22403 Nonsense Mutation detected in F1 DNA During 2014
sa22402 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22403
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114053 Nonsense 235 558 2 2
Genomic Location:
Chromosome 14 (position 972983)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAACCGCTCTTCATCTTCCTCTCTTTCCAGGCGGTGCACACTCCCTTA[C/T]AGTCGCCAAAGGAATACGTTTATCCCTACCGCCGCATGGGGAACATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114053 Nonsense 342 558 2 2
Genomic Location:
Chromosome 14 (position 972660)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAGGCGTAGGAGGAGAGTTAGCAGAGCTTTGATTCACATCACCGACTG[G/A]TATCCGACCCTAATGAGACTTGCCGGAGGAAACGTTTCCCAAGCCGAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pm9lpx49