FRRS1 (3 of 3)

Ensembl ID:
ENSDARG00000077605
Description:
ferric-chelate reductase 1 [Source:HGNC Symbol;Acc:27622]
Human Orthologue:
FRRS1
Human Description:
ferric-chelate reductase 1 [Source:HGNC Symbol;Acc:27622]
Mouse Orthologue:
Frrs1
Mouse Description:
ferric-chelate reductase 1 Gene [Source:MGI Symbol;Acc:MGI:108076]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24521 Nonsense Mutation detected in F1 DNA During 2014
sa17074 Nonsense Available for shipment Available now
sa4291 Nonsense Mutation detected in F1 DNA During 2014
sa24522 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24521
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100092 Nonsense 201 562 6 19
ENSDART00000113304 Nonsense 208 597 5 17
Genomic Location:
Chromosome 24 (position 30804977)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTCTCGTCAGTTCACAGCTGATGGCTGTGGAATCGAGAAGTCCTGTT[T/A]GAGAGATCCAGAGGGCTGTGAACCACAAAATGACGCTGCGTGTCACTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100092 Nonsense 290 562 9 19
ENSDART00000113304 Nonsense 305 597 9 17
Genomic Location:
Chromosome 24 (position 30806189)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTTYTAAAAGACAGGGCTTGGAGGCTATCAGATGGAGTGATTCAGTG[T/A]AGCTTTCGCAGAGACGTTCATCAGCCGCCTGAAGATCTGAACAGATTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4291
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100092 Nonsense 390 562 11 19
ENSDART00000113304 Nonsense 405 597 11 17
Genomic Location:
Chromosome 24 (position 30807429)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACCGCTGGGGTCATCATGGCAAGATACTTCAAACCCGACTGGCCGGAG[C/T]AGAACATTTTGGGGCAGAAGGTCTGGTTTCAGGTGGGCACTGCTTTGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100092 Nonsense 436 562 13 19
ENSDART00000113304 Nonsense 451 597 13 17
Genomic Location:
Chromosome 24 (position 30810191)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTCTAATCCATTTTGTGTTGTTCACAGCGGGCAGGAATACACCCGTA[T/A]TTGGGTTGTGTTGTCATGGCACTGACTCTCATCCAACCTGTCATGGCACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/090841st