si:ch211-269m17.1

Ensembl ID:
ENSDARG00000077596
ZFIN ID:
ZDB-GENE-091204-154
Human Orthologue:
KIAA1045
Human Description:
KIAA1045 [Source:HGNC Symbol;Acc:29180]
Mouse Orthologue:
N28178
Mouse Description:
expressed sequence N28178 Gene [Source:MGI Symbol;Acc:MGI:2140712]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41631 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113666 Essential Splice Site 348 409 5 7
ENSDART00000145936   None 346 None 6
Genomic Location (Zv9):
Chromosome 10 (position 17943689)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17956035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCATGGTTTCAAAAGACTAACAAAGAATCACAGTCCTGCAATGTCAG[G/A]TAAGCCAATTATGTAGTCATTTAGGTTAATCACAGTTAGCATGATATTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link