LOC100333185

Ensembl ID:
ENSDARG00000077585
Human Orthologue:
DNAJC30
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 30 [Source:HGNC Symbol;Acc:16410]
Mouse Orthologue:
Dnajc30
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 30 Gene [Source:MGI Symbol;Acc:MGI:1913364]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31787 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31787
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110741 Nonsense 152 328 1 2
Genomic Location (Zv9):
Chromosome 10 (position 33848620)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32949969
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTATGGCACTTTATGTCCTCCAGCAGAGCGTATAGCGGCACGCAGTA[T/A]AACAGCCGTCCAGAGGAGCCCTTACACAAATCAAAATCTGCTTATTATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link