cln6

Ensembl ID:
ENSDARG00000077584
ZFIN ID:
ZDB-GENE-041010-57
Description:
ceroid-lipofuscinosis, neuronal 6, late infantile, variant [Source:RefSeq peptide;Acc:NP_001005982]
Human Orthologue:
CLN6
Human Description:
ceroid-lipofuscinosis, neuronal 6, late infantile, variant [Source:HGNC Symbol;Acc:2077]
Mouse Orthologue:
Cln6
Mouse Description:
ceroid-lipofuscinosis, neuronal 6 Gene [Source:MGI Symbol;Acc:MGI:2159324]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10876 Nonsense Available for shipment Available now
sa904 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10876
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109872 Nonsense 6 298 1 7
Genomic Location:
Chromosome 7 (position 35942679)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATAAATAGCTATAAAGAAGATATCGATTAACCATGCGGAGAAGACCA[C/T]AGTCTGCAACTTTCACATCGGCATTTCTGAGGTAACGTTAACGTTATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109872 Essential Splice Site 210 298 6 7
Genomic Location:
Chromosome 7 (position 35945460)
KASP Assay ID:
554-0811.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCACCTCAGGTTGGCTGCTGCTTGGCCCCAGCGCTGTGTATTATTGG[T/C]AAGTCAGCTATTCACATCAGTTGGTAGCATTTTCTTTAAGAGATAGAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hwkwsjcl