LOC564450

Ensembl ID:
ENSDARG00000077583
Human Orthologue:
B3GNT1
Human Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 [Source:HGNC Symbol;Acc:15685]
Mouse Orthologue:
B3gnt1
Mouse Description:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:191968

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34005 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111708 Nonsense 329 444 2 3
Genomic Location (Zv9):
Chromosome 7 (position 8301428)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 7240011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTTTTACGATGAACTCTGCTCTCGCTGTCAGGCTCCAACTAACTACT[C/A]GCTGTGGGTTAACCTGGCCAGTAAAAGCTCGGGCCCGCTGGAGGTTTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link