si:ch211-284g18.3

Ensembl ID:
ENSDARG00000077581
ZFIN ID:
ZDB-GENE-030131-6450
Description:
ZZ-type zinc finger-containing protein 3 [Source:RefSeq peptide;Acc:NP_001093497]
Human Orthologue:
ZZZ3
Human Description:
zinc finger, ZZ-type containing 3 [Source:HGNC Symbol;Acc:24523]
Mouse Orthologue:
Zzz3
Mouse Description:
zinc finger, ZZ domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1920453]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11603 Splice Site, Nonsense Available for shipment Available now
sa39772 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11603
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114471 Splice Site, Nonsense 629 871 5 11
ENSDART00000134308   None 236 None 2
ENSDART00000137768 Splice Site, Nonsense 629 871 6 12

The following transcripts of ENSDARG00000077581 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 8608451)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9026105
KASP Assay ID:
2259-1597.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAACCAGAGCAAACCAGACACCTTCAACCAGCTGTGGACCATCGAGGAG[C/T]AGGTAGTACTAGTAGCTGTGAACTCTGAGACGTCTATAAACAAATTTAAR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114471 Nonsense 701 871 8 11
ENSDART00000134308   None 236 None 2
ENSDART00000137768 Nonsense 701 871 9 12

The following transcripts of ENSDARG00000077581 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 8613076)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9030730
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTATTGACTGAACGTCTTGTTTGTGACCGCAGGCCTCAAGTAAGCGA[C/T]AGCACCACCTCAACAAACACCTGTACAGGCCCTCAACGTTCCTCACCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link