LOC570420

Ensembl ID:
ENSDARG00000077580
Human Orthologue:
C21orf29
Human Description:
chromosome 21 open reading frame 29 [Source:HGNC Symbol;Acc:1268]
Mouse Orthologue:
C330046G03Rik
Mouse Description:
RIKEN cDNA C330046G03 gene Gene [Source:MGI Symbol;Acc:MGI:2671932]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40633 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110470 Nonsense 364 676 7 12
Genomic Location (Zv9):
Chromosome 6 (position 9156613)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8404051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGCTATGGCTCATCGGGCCACCAAACCAGGCTCTGGCATCTACCGCTG[G/A]AGCCACGGACACTTCCAGCTCTACCAGAACATCAGCACCTTCAAGGCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link