tmprss13b

Ensembl ID:
ENSDARG00000077573
ZFIN ID:
ZDB-GENE-090309-2
Description:
Novel transmembrane protease serine family protein [Source:UniProtKB/TrEMBL;Acc:A5PF55]
Human Orthologue:
TMPRSS13
Human Description:
transmembrane protease, serine 13 [Source:HGNC Symbol;Acc:29808]
Mouse Orthologue:
Tmprss13
Mouse Description:
transmembrane protease, serine 13 Gene [Source:MGI Symbol;Acc:MGI:2682935]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16531 Essential Splice Site Available for shipment Available now
sa13510 Nonsense Available for shipment Available now
sa8506 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16531
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084839 Essential Splice Site 5 475 None 13
ENSDART00000084841 Essential Splice Site None 279 None 16
ENSDART00000133437 Essential Splice Site 5 239 None 8

The following transcripts of ENSDARG00000077573 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 39500699)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCTACCTGACCGCTTWAAACSGATACTCACATATGGAGCACAAACAGG[T/C]ACAAATATTGTTTTAAACAAACATAGAAAAAACAACTTTTACATTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084839 Nonsense 262 475 8 13
ENSDART00000084841 Nonsense 69 279 8 16
ENSDART00000133437 None None 239 None 8

The following transcripts of ENSDARG00000077573 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 39493723)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGGTCACTGGCCATGGCAGGCCAGTCTGCATTTTCAAGGAAAGCACT[C/A]MTGTGGAGGATCTCTGGTGGCTCCAGACTTTATCATCACTGCTGCTCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8506
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084839 Nonsense 310 475 9 13
ENSDART00000084841 Nonsense 114 279 10 16
ENSDART00000133437 None None 239 None 8

The following transcripts of ENSDARG00000077573 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 39493406)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGTGTACATAGGTTTCGTGTCCCAGCTCAAGCTGCCCAGYCCGTATTA[T/A]GTAAAGGAAATCATTTTACATGAAAAGTACAACCCAACAACAAAAAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9z9uok9g