CDH16

Ensembl ID:
ENSDARG00000077570
Description:
cadherin 16, KSP-cadherin [Source:HGNC Symbol;Acc:1755]
Human Orthologue:
CDH16
Human Description:
cadherin 16, KSP-cadherin [Source:HGNC Symbol;Acc:1755]
Mouse Orthologue:
Cdh16
Mouse Description:
cadherin 16 Gene [Source:MGI Symbol;Acc:MGI:106671]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7280 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21051 Nonsense Mutation detected in F1 DNA During 2014
sa21050 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7280
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109534 Essential Splice Site 91 831 5 22
Genomic Location:
Chromosome 7 (position 45940813)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTGAGCAGAMGAATGTACATWTTCCCAGAGCTATTTGTCTTTATTTC[A/T]AGCTACNNNNNNNNNNNNNNNTGTCACATGKGTCCCTGACTCTCAGTTSA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109534 Nonsense 234 831 9 22
Genomic Location:
Chromosome 7 (position 45929626)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTCTTCTCCACTGGAACTGTGCTGGTGGAAGTGACTGGGAATGCAT[G/A]GGCCTCTCCAGACCCTGTGAGGCTGCAGGAGAATCTGCCTGGACCATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109534 Essential Splice Site 720 831 17 22
Genomic Location:
Chromosome 7 (position 45858166)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCAGTGATGCCACTGTCCGCCGCACCTGGAAACTCACCCCCATCAATG[G/T]TTCGTGTATCCTACTCTTCCACCTGTTGAGCAATAGCTGTGTTGAGTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9fd02u5s