lrrn3

Ensembl ID:
ENSDARG00000077569
ZFIN ID:
ZDB-GENE-061220-7
Description:
cDNA, clone cssl:d0329 [Source:UniProtKB/TrEMBL;Acc:A8BAZ5]
Human Orthologue:
LRRN3
Human Description:
leucine rich repeat neuronal 3 [Source:HGNC Symbol;Acc:17200]
Mouse Orthologue:
Lrrn3
Mouse Description:
leucine rich repeat protein 3, neuronal Gene [Source:MGI Symbol;Acc:MGI:106036]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9589 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9589
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109295 Nonsense 286 691 1 1
Genomic Location:
Chromosome 25 (position 22013341)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATCCCATCGAGAGGATCCAAAGGGGTGACTTTGTCGACATGATCCATT[T/A]GAAAGAACTTGGTATTAACAGCATGCCAGAGTTAGTTTCAATCGACAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qd2eclhp