LOC569547

Ensembl ID:
ENSDARG00000077567
Human Orthologue:
ANGEL1
Human Description:
angel homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:19961]
Mouse Orthologue:
Angel1
Mouse Description:
angel homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1915987]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43019 Nonsense Mutation detected in F1 DNA During 2016
sa9407 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43019
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109891 Nonsense 11 667 1 12
Genomic Location (Zv9):
Chromosome 17 (position 53141201)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52526768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTAGCGGCTTTTCCAGATGATCGTCAGTGCGATGTTTTATGCGCTTTA[T/A]CCGCTTTCCAGACTCCTCGACAGAGTTTCAGGTGAGACTGTTCCTGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9407
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109891 Nonsense 473 667 7 12
Genomic Location (Zv9):
Chromosome 17 (position 53153173)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52538740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACGCTGATCACCACCGGGGAGCTCTACTACCACGGCYTACCGACATG[G/A]ATGGTGAGAAACCCCGATTACTGACNATWTTTACAATACACAGTTAAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link