si:ch211-145m1.4

Ensembl ID:
ENSDARG00000077562
ZFIN IDs:
ZDB-GENE-080327-14, ZDB-GENE-080327-14, ZDB-GENE-081104-122
Description:
Novel protein similar to vertebrate leucine rich repeat transmembrane neuronal 4 (LRRTM4) [Source:Un
Human Orthologue:
LRRTM4
Human Description:
leucine rich repeat transmembrane neuronal 4 [Source:HGNC Symbol;Acc:19411]
Mouse Orthologue:
Lrrtm4
Mouse Description:
leucine rich repeat transmembrane neuronal 4 Gene [Source:MGI Symbol;Acc:MGI:2389180]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25386 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109348 Nonsense 500 507 3 3
ENSDART00000134131 Nonsense 95 102 1 1
Genomic Location (Zv9):
Chromosome 8 (position 6985901)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 6372704
KASP Assay ID:
554-7392.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGAGACCATGGACTCTTTGGTTAACGGGGCGTGCACCTGCACCATCT[C/A]GGGCTCCAGAGAGTGCGAGGTATGACCTACCGCTAATCAAACCGCATTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link