si:ch211-145n14.3

Ensembl ID:
ENSDARG00000077547
ZFIN ID:
ZDB-GENE-091204-144
Human Orthologue:
TMLHE
Human Description:
trimethyllysine hydroxylase, epsilon [Source:HGNC Symbol;Acc:18308]
Mouse Orthologue:
Tmlhe
Mouse Description:
trimethyllysine hydroxylase, epsilon Gene [Source:MGI Symbol;Acc:MGI:2180203]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32359 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32359
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111713 Essential Splice Site 108 410 2 7
ENSDART00000136025 Essential Splice Site 59 361 1 6
Genomic Location (Zv9):
Chromosome 21 (position 42082033)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43681079
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCAGGCCTTCCAAGAGCAGAGTGGACGAACACAACCTCTTCCTGACGT[G/T]TGAGTGGATTAATCTTGCTTAAACGTTAAACAAATCCGATGCCTCTTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link