LOC562614

Ensembl ID:
ENSDARG00000077546
Human Orthologue:
ZDHHC1
Human Description:
zinc finger, DHHC-type containing 1 [Source:HGNC Symbol;Acc:17916]
Mouse Orthologue:
Zdhhc1
Mouse Description:
zinc finger, DHHC domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918046]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40947 Nonsense Mutation detected in F1 DNA During 2016
sa15614 Nonsense Available for shipment Available now
sa3625 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110552 Nonsense 48 562 1 11
Genomic Location:
Chromosome 7 (position 36648687)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGGAGCTGGCCTCCACACCCTTTCCAGTTCCTGGCCTGGCTGCTTTA[T/A]CTCTACTTTGCTGTCACTGGTTTTGGTGTATTTGTTCCTCTGCTCCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110552 Nonsense 250 562 5 11
Genomic Location:
Chromosome 7 (position 36652336)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGCTCTWGCAGGAGTCACCATTGCCCTGGGTCTGCTGTCTGCWCTTCTGT[T/A]GGGCCATTTACTCTGCTTCCACATRTACCTCAGTGCGTTCACTMTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3625
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110552 Nonsense 268 562 6 11
Genomic Location:
Chromosome 7 (position 36653816)
KASP Assay ID:
2259-9137.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTATTTTGTGTCATTCTTTGTTTTAGTGTGGAACAGACTCAGCACATA[T/G]GAGTATATTGTGCGACAACGGCATCGGCAAGAGGCYGGAGATTCCAGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link