LOC562614

Ensembl ID:
ENSDARG00000077546
Human Orthologue:
ZDHHC1
Human Description:
zinc finger, DHHC-type containing 1 [Source:HGNC Symbol;Acc:17916]
Mouse Orthologue:
Zdhhc1
Mouse Description:
zinc finger, DHHC domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918046]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40947 Nonsense Mutation detected in F1 DNA During 2016
sa15614 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110552 Nonsense 48 562 1 11
Genomic Location (Zv9):
Chromosome 7 (position 36648687)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34922530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATGGAGCTGGCCTCCACACCCTTTCCAGTTCCTGGCCTGGCTGCTTTA[T/A]CTCTACTTTGCTGTCACTGGTTTTGGTGTATTTGTTCCTCTGCTCCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110552 Nonsense 250 562 5 11
Genomic Location (Zv9):
Chromosome 7 (position 36652336)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34926179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGCTCTWGCAGGAGTCACCATTGCCCTGGGTCTGCTGTCTGCWCTTCTGT[T/A]GGGCCATTTACTCTGCTTCCACATRTACCTCAGTGCGTTCACTMTTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link