si:ch211-251j10.5

Ensembl ID:
ENSDARG00000077536
ZFIN IDs:
ZDB-GENE-030131-1217, ZDB-GENE-081105-64
Description:
U5 small nuclear ribonucleoprotein 200 kDa helicase [Source:RefSeq peptide;Acc:NP_001116729]
Human Orthologues:
HELQ, POLQ, SNRNP200
Human Descriptions:
helicase, POLQ-like [Source:HGNC Symbol;Acc:18536]
polymerase (DNA directed), theta [Source:HGNC Symbol;Acc:9186]
small nuclear ribonucleoprotein 200kDa (U5) [Source:HGNC Symbol;Acc:30859]
Mouse Orthologues:
Helq, Polq, Snrnp200
Mouse Descriptions:
helicase, POLQ-like Gene [Source:MGI Symbol;Acc:MGI:2176740]
polymerase (DNA directed), theta Gene [Source:MGI Symbol;Acc:MGI:2155399]
small nuclear ribonucleoprotein 200 (U5) Gene [Source:MGI Symbol;Acc:MGI:2444401]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21333 Nonsense Available for shipment Available now
sa17773 Nonsense Available for shipment Available now
sa25398 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109885 Nonsense 270 2134 7 45

The following transcripts of ENSDARG00000077536 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31897303)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31040029
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGAAGGATCTTCACCCTCGAGACATCGATGCCTTCTGGCTTCAGCGA[C/T]AGCTCAGCCGCTTCTACAACGATGCCATCGTGTCCCAGAAAAAAGCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17773
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109885 Nonsense 1016 2134 22 45

The following transcripts of ENSDARG00000077536 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31890504)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31033230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCTGCTAAAGCCCACACTGAGTGAGATCGAGCTCTTCAGGGTGTTCT[C/A]GCTTTCATCKGAGTTTAGGAAMATTACTGTCAGAGAGGTACGTGCCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109885 Nonsense 1074 2134 24 45

The following transcripts of ENSDARG00000077536 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 31890148)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31032874
KASP Assay ID:
554-7358.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGCTGCTGCAGGCATATATCTCTCAGCTCAAACTGGAGGGCTTTGCTT[T/A]AATGGCTGACATGGTCTATGTGACGCAGGCGAGTGTAGAATAAAATCTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Aging (facial): A genome-wide association study in Caucasian women points out a putative role of the STXBP5L gene in facial photoaging. (View Study)
  • Menopause (age at onset): Meta-analyses identify 13 loci associated with age at menopause and highlight DNA repair and immune pathways. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link