bat3l

Ensembl ID:
ENSDARG00000077531
ZFIN IDs:
ZDB-GENE-060307-2, ZDB-GENE-060825-176
Description:
hypothetical protein LOC751663 [Source:RefSeq peptide;Acc:NP_001038845]
Human Orthologue:
BAT3
Human Description:
HLA-B associated transcript 3 [Source:HGNC Symbol;Acc:13919]
Mouse Orthologue:
Bat3
Mouse Description:
HLA-B-associated transcript 3 Gene [Source:MGI Symbol;Acc:MGI:1919439]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30712 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32248 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088760 Essential Splice Site None 156 2 4
ENSDART00000135128   None 1160 None 23
Genomic Location (Zv9):
Chromosome 19 (position 31755672)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 30922961
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTTTAATCATTTTTAGAAACTTTTTCCATCTTCTCACCTTTTAAAA[G/T]AAATTTTGGAGGTCATGGAGGAATCAGGAGTCATAGAGGTGACCGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32248
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088760 Nonsense 27 156 3 4
ENSDART00000135128 Nonsense 27 1160 2 23
Genomic Location (Zv9):
Chromosome 19 (position 31755078)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 30922367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTTTGTTGCTGTTAATGTTTTGGATGTCACCTTTCTTACTTTCAGTG[G/A]ACAGTGAAGCAGTTTAAGGAGCACATCGCTGCTTCTGTTGAAATCTCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lung adenocarcinoma: A genome-wide association study of lung cancer identifies a region of chromosome 5p15 associated with risk for adenocarcinoma. (View Study)
  • Lung cancer: Common 5p15.33 and 6p21.33 variants influence lung cancer risk. (View Study)
  • Lung cancer: Deciphering the impact of common genetic variation on lung cancer risk: a genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link