ahctf1

Ensembl ID:
ENSDARG00000077530
ZFIN ID:
ZDB-GENE-070521-2
Description:
Ahctf1 protein [Source:UniProtKB/TrEMBL;Acc:A5D6S7]
Human Orthologue:
AHCTF1
Human Description:
AT hook containing transcription factor 1 [Source:HGNC Symbol;Acc:24618]
Mouse Orthologue:
Ahctf1
Mouse Description:
AT hook containing transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1915033]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4699 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23014 Nonsense Mutation detected in F1 DNA During 2014
sa9115 Essential Splice Site Mutation detected in F1 DNA During 2014
sa664 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa4699
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115321 Essential Splice Site 125 2527 2 35
Genomic Location:
Chromosome 17 (position 12104590)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCTCGGTATCTCTCGTGTTGTCAAGGCTGTGGTAATTCCAGGCAGAG[T/A]GAGTGCAGTTTTATTTCTGTGTTTTTCAGATGCTATTACAGTTTCATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23014
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115321 Nonsense 416 2527 8 35
Genomic Location:
Chromosome 17 (position 12100512)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGTATTTGACATAAACAGATGGTACCACGCTCAGATGCCAGATTCAT[T/A]GAGGTCAGTATGCTATTAGTAATGCACTCAGATTTGATGGAAGGACATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115321 Essential Splice Site 417 2527 8 35
Genomic Location:
Chromosome 17 (position 12100507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTGACATAAACAGATGGTACCACGCTCAGATGCCAGATTCATTGAGG[T/G]CAGTATGCTATTAGTAATGCACTCAGATTTGATGGAAGGAYATGTTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa664
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115321 Nonsense 468 2527 9 35
Genomic Location:
Chromosome 17 (position 12100250)
KASP Assay ID:
554-0572.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGCGCAGTCTAAGCAGAGGTCTCCCCTATACATGTCCTCCACCAGAA[C/T]AGTTCTTCAATCCCACCACATACAACTTTGGCAAGACCTTTTCTTTATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0i89igdr