TDRD7 (1 of 2)

Ensembl ID:
ENSDARG00000077523
Description:
tudor domain containing 7 [Source:HGNC Symbol;Acc:30831]
Human Orthologue:
TDRD7
Human Description:
tudor domain containing 7 [Source:HGNC Symbol;Acc:30831]
Mouse Orthologue:
Tdrd7
Mouse Description:
tudor domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2140279]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5449 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108540 Nonsense 824 1091 15 17
Genomic Location:
Chromosome 7 (position 62596934)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCTTTACCAGCAAGAACTTCCATGACACAAGTTGCAGTTTAAACCAG[C/T]AGTTGGCTGATTCAGACTTGTGGAACCATCAGAAGGATGTTTTCTTAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u3loxph0