TDRD7 (1 of 2)

Ensembl ID:
ENSDARG00000077523
Description:
tudor domain containing 7 [Source:HGNC Symbol;Acc:30831]
Human Orthologue:
TDRD7
Human Description:
tudor domain containing 7 [Source:HGNC Symbol;Acc:30831]
Mouse Orthologue:
Tdrd7
Mouse Description:
tudor domain containing 7 Gene [Source:MGI Symbol;Acc:MGI:2140279]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31611 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108540 Nonsense 264 1091 6 17
Genomic Location (Zv9):
Chromosome 7 (position 62574622)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 61621820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAACAAGCATAGCAATGGCCTCTGGGTATCCAAGCTGCCTCAGCTGTAT[C/T]GAGAGCATTATAAACAAGACCTGCCCAGTGAAGCCCTAAAAGAGCTGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link