RECQL4

Ensembl ID:
ENSDARG00000077516
Description:
RecQ protein-like 4 [Source:HGNC Symbol;Acc:9949]
Human Orthologue:
RECQL4
Human Description:
RecQ protein-like 4 [Source:HGNC Symbol;Acc:9949]
Mouse Orthologue:
Recql4
Mouse Description:
RecQ protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:1931028]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32227 Nonsense Available for shipment Available now
sa23412 Essential Splice Site Available for shipment Available now
sa25080 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15595 Essential Splice Site Available for shipment Available now
sa23411 Essential Splice Site Available for shipment Available now
sa36752 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109130 Nonsense 364 1459 5 24
Genomic Location (Zv9):
Chromosome 19 (position 3319445)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2920877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGATGATGAGAACTTATCAGAGGAGCCTGAATTTACTCCAAACACTAAA[C/T]AACGCAAAACCAAGGCTAGAAAAGATCAAGATTCAGGTGCAAAAACGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109130 Essential Splice Site 511 1459 6 24
Genomic Location (Zv9):
Chromosome 19 (position 3318820)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2920252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCCACGTCAAAGGGTTTGCTTTGAGAGGAGCTGCACTGAGAAAACAG[G/A]TTGGTTGACAAAATCAAACACCTACTTGAAATTTATTGTTCATGCAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109130 Essential Splice Site 683 1459 11 24
Genomic Location (Zv9):
Chromosome 19 (position 3313184)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2914616
KASP Assay ID:
554-7736.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAACCAGATTTTTTTTTTTGGATCTGTTGATGTTTTCGTGTGTCTTCA[G/T]GTTTGTCCACACTGGTGGTTTTGTCCACTGGTATGGGCAAGTCTCTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109130 Essential Splice Site 756 1459 12 24
Genomic Location (Zv9):
Chromosome 19 (position 3312875)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2914307
KASP Assay ID:
2261-2787.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCCACTCCAACATGTCTGCGAAACAGAGAGAGGCGGCCATTGAGAAG[G/A]TAGAAGAGTAATRCTAATAAAATGCAAYTGATGTCCAATTTCTTGTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109130 Essential Splice Site 947 1459 15 24
Genomic Location (Zv9):
Chromosome 19 (position 3308385)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2909817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCAGGAGGACGACGACAACCCTGTGGGCAAGAAGAAGAAAGCTCTGG[G/T]TAAATACTGCAACGGTACAGTAGGGAGACATCTGTGACTTATTATTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109130 Essential Splice Site 1264 1459 20 24
Genomic Location (Zv9):
Chromosome 19 (position 3301869)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 2903301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTGGTGAAGCGAGGACTCAGACAGCTGCAGTGGGGCTCAGACACAGG[T/C]CAGCCATGGATGAAGCCATGCACGCCACACACAACCCTCCAAACGAACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link