RECQL4

Ensembl ID:
ENSDARG00000077516
Description:
RecQ protein-like 4 [Source:HGNC Symbol;Acc:9949]
Human Orthologue:
RECQL4
Human Description:
RecQ protein-like 4 [Source:HGNC Symbol;Acc:9949]
Mouse Orthologue:
Recql4
Mouse Description:
RecQ protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:1931028]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23412 Essential Splice Site Mutation detected in F1 DNA During 2014
sa25080 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15595 Essential Splice Site Available for shipment Available now
sa23411 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109130 Essential Splice Site 511 1459 6 24
Genomic Location:
Chromosome 19 (position 3318820)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCCACGTCAAAGGGTTTGCTTTGAGAGGAGCTGCACTGAGAAAACAG[G/A]TTGGTTGACAAAATCAAACACCTACTTGAAATTTATTGTTCATGCAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109130 Essential Splice Site 683 1459 11 24
Genomic Location:
Chromosome 19 (position 3313184)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAACCAGATTTTTTTTTTTGGATCTGTTGATGTTTTCGTGTGTCTTCA[G/T]GTTTGTCCACACTGGTGGTTTTGTCCACTGGTATGGGCAAGTCTCTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109130 Essential Splice Site 756 1459 12 24
Genomic Location:
Chromosome 19 (position 3312875)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCCACTCCAACATGTCTGCGAAACAGAGAGAGGCGGCCATTGAGAAG[G/A]TAGAAGAGTAATRCTAATAAAATGCAAYTGATGTCCAATTTCTTGTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109130 Essential Splice Site 947 1459 15 24
Genomic Location:
Chromosome 19 (position 3308385)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCAGGAGGACGACGACAACCCTGTGGGCAAGAAGAAGAAAGCTCTGG[G/T]TAAATACTGCAACGGTACAGTAGGGAGACATCTGTGACTTATTATTCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uvbvv37e