LOC558743

Ensembl ID:
ENSDARG00000077514
Human Orthologue:
SLITRK1
Human Description:
SLIT and NTRK-like family, member 1 [Source:HGNC Symbol;Acc:20297]
Mouse Orthologue:
Slitrk1
Mouse Description:
SLIT and NTRK-like family, member 1 Gene [Source:MGI Symbol;Acc:MGI:2679446]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44417 Nonsense Mutation detected in F1 DNA During 2016
sa38206 Nonsense Available for shipment Available now
sa30416 Nonsense Mutation detected in F1 DNA During 2016
sa24774 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44417
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112983 Nonsense 7 688 1 1
Genomic Location (Zv9):
Chromosome Zv9_NA675 (position 162959)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150474.1 162959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGTCGGGGATGATTGTGTCGTATTAAAAATGCTGCTTTGGATTGTGT[T/A]GCTGAAGGCGGCTCTTTGTGTAGCTATCGGGAATGTTACAAGGGACGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112983 Nonsense 159 688 1 1
Genomic Location (Zv9):
Chromosome Zv9_NA675 (position 162503)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150474.1 162503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGACATCGACCCGTCTGTGTTCAGGGACTTGAGTAAGCTTGAAGTTT[T/A]AATCTTGAACGACAACCTTATTAGCGCTCTTCCCATCAACGTGTTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112983 Nonsense 388 688 1 1
Genomic Location (Zv9):
Chromosome Zv9_NA675 (position 161817)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150474.1 161817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCACGAGTTAAATCTGCGCGACAACAACATTCACACCGTGAGAAGGAAC[C/T]AGCTTAGAGGCTACCATAGTTTAAACTTGCTCGATTTGGGGGGGAATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24774
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112983 Nonsense 576 688 1 1
Genomic Location (Zv9):
Chromosome Zv9_NA675 (position 161251)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150474.1 161251
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGGGATTTCCGCCGGATCAGGAATGATCTGATGTGCCCTCAGCTCTA[C/A]GACAAGATCTCCCCCACCTCTCTGTCCAAAAACAGCACTCTCCCTGCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link