LOC100329789

Ensembl ID:
ENSDARG00000077508
Human Orthologue:
CNNM4
Human Description:
cyclin M4 [Source:HGNC Symbol;Acc:105]
Mouse Orthologue:
Cnnm4
Mouse Description:
cyclin M4 Gene [Source:MGI Symbol;Acc:MGI:2151060]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21890 Essential Splice Site Available for shipment Available now
sa21889 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21890
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115310 Essential Splice Site 688 757 6 8
Genomic Location (Zv9):
Chromosome 11 (position 21293621)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150361.1 22036
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACACACCTGACTTCAACGTGCGCGCGCTCACTGACCTGCAGTACGCC[A/T]AGGTAACACACACACACACACACACACACACACACTCACACGCATGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21889
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115310 Essential Splice Site 688 757 7 8
Genomic Location (Zv9):
Chromosome 11 (position 21293202)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150361.1 21617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACAGCAGCAGCGGCAGGTCATCAGGGTGTGTTACTCTGTTATTGTCT[G/T]CTTGCAGATCACTCGCTCTCAGTACCAGAACGGCCTGTTGGCTTCAAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link