LOC100329789

Ensembl ID:
ENSDARG00000077508
Human Orthologue:
CNNM4
Human Description:
cyclin M4 [Source:HGNC Symbol;Acc:105]
Mouse Orthologue:
Cnnm4
Mouse Description:
cyclin M4 Gene [Source:MGI Symbol;Acc:MGI:2151060]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21890 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21889 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115310 Essential Splice Site 688 757 6 8
Genomic Location:
Chromosome 11 (position 21293621)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACACACCTGACTTCAACGTGCGCGCGCTCACTGACCTGCAGTACGCC[A/T]AGGTAACACACACACACACACACACACACACACACTCACACGCATGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21889
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115310 Essential Splice Site 688 757 7 8
Genomic Location:
Chromosome 11 (position 21293202)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACAGCAGCAGCGGCAGGTCATCAGGGTGTGTTACTCTGTTATTGTCT[G/T]CTTGCAGATCACTCGCTCTCAGTACCAGAACGGCCTGTTGGCTTCAAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r2e0wc1p