tjp1

Ensembl ID:
ENSDARG00000077506
ZFIN ID:
ZDB-GENE-031001-2
Human Orthologue:
TJP1
Human Description:
tight junction protein 1 (zona occludens 1) [Source:HGNC Symbol;Acc:11827]
Mouse Orthologue:
Tjp1
Mouse Description:
tight junction protein 1 Gene [Source:MGI Symbol;Acc:MGI:98759]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40924 Nonsense Mutation detected in F1 DNA During 2016
sa7069 Nonsense Mutation detected in F1 DNA During 2016
sa20982 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13285 Nonsense Available for shipment Available now
sa34097 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108721 Nonsense 436 1699 10 29
ENSDART00000148347 Nonsense 361 1637 9 28
Genomic Location:
Chromosome 7 (position 32439466)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGAGATGAGGAGCGCATCTCTAAACCAGCGGCTCTATCCACTCCAGTT[A/T]AGATGGCTGAGGATGCTCTTCTGGCTCCGCCCAGCGAACAGCCCGGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108721 Nonsense 449 1699 10 29
ENSDART00000148347 Nonsense 374 1637 9 28
Genomic Location:
Chromosome 7 (position 32439505)
KASP Assay ID:
554-5211.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACTCCAGTTAAGATGGCTGAGGATGCTCTTCTGGCYCCGCCCAGCGAA[C/T]AGCCCGGGGACAAACAGATCCCWCCACTGCCAGGTCWGGACTTTCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20982
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108721 Essential Splice Site 655 1699 14 29
ENSDART00000148347 Essential Splice Site 580 1637 13 28
Genomic Location:
Chromosome 7 (position 32446437)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAAGAACCACCAGGAGGTGGAAAGAGGCATCATTCCCAACAAGAACAG[G/C]TGATCCTACTATAATGCATCAACAGTAAATAGACAACCTTCAGCTATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108721 Nonsense 1172 1699 22 29
ENSDART00000148347 Nonsense 1097 1637 21 28
Genomic Location:
Chromosome 7 (position 32460365)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGTCACCCTCAGWCACGAAACGACACCGGCTACGACACAGGTCGACCT[C/T]GATAYGGCAAACCAACCTCTGGACCAAWCCGACACGATGAACCACCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108721 Nonsense 1223 1699 22 29
ENSDART00000148347 Nonsense 1148 1637 21 28
Genomic Location:
Chromosome 7 (position 32460518)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAACAATACTACGACCCTTCCCAAAGGCCTTCCTACACTCAAGCTCCA[C/T]AAAAAGGCTATATGAACTCTGAAGCACCGGTAACGCCACCCAAACCTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link