rbp4

Ensembl ID:
ENSDARG00000077505
ZFIN ID:
ZDB-GENE-000210-19
Description:
retinol-binding protein 4 [Source:RefSeq peptide;Acc:NP_570995]
Human Orthologue:
RBP4
Human Description:
retinol binding protein 4, plasma [Source:HGNC Symbol;Acc:9922]
Mouse Orthologue:
Rbp4
Mouse Description:
retinol binding protein 4, plasma Gene [Source:MGI Symbol;Acc:MGI:97879]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35200 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109588 Nonsense 154 192 5 6
ENSDART00000146291 Nonsense 167 169 4 4

The following transcripts of ENSDARG00000077505 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 5741582)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5081456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGATGAGGACGGCACCTGTCTGGACGGATATTCCTTCATTTTCTCC[A/T]GACATCCTGACGGGCTCAGGCCTGAAGACCAGGCCATAGTGACACAGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link