LOC100005951

Ensembl ID:
ENSDARG00000077497
Human Orthologue:
IGSF10
Human Description:
immunoglobulin superfamily, member 10 [Source:HGNC Symbol;Acc:26384]
Mouse Orthologue:
Igsf10
Mouse Description:
immunoglobulin superfamily, member 10 Gene [Source:MGI Symbol;Acc:MGI:1923481]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22567 Nonsense Mutation detected in F1 DNA During 2014
sa22568 Nonsense Available for shipment Available now
sa10949 Nonsense Available for shipment Available now
sa16954 Nonsense Available for shipment Available now
sa22569 Nonsense Mutation detected in F1 DNA During 2014
sa24972 Nonsense Mutation detected in F1 DNA During 2014
sa9744 Nonsense Available for shipment Available now
sa18534 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113091 Nonsense 552 2497 4 6
Genomic Location:
Chromosome 15 (position 1092451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGAATTCTTTCTGTAAAATCAGCTGAAATCTCAGACACGGGTGTCTA[T/A]CATTGCATTGCGACCAGCTATCTGGATGCAGATGTTCTTGCCTTTAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113091 Nonsense 687 2497 4 6
Genomic Location:
Chromosome 15 (position 1092854)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATAGCACAATGCCAACTCATGTAAAGGAATCTAACCATCGTGTTGTA[C/T]AAATTATAGACAATAGTCAGACACTTGGAAGTAGGTATCTCTCTCAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10949
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113091 Nonsense 1990 2497 6 6
Genomic Location:
Chromosome 15 (position 1098400)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGAACGCTGTACCTGAAYACAGTGGGTACYGACGAGGAAGGGGACTA[T/A]ACCTGTTATGCTGAWAACAAATTGGGTAAAGACAAGAWGCATGTTCACAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16954
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113091 Nonsense 2074 2497 6 6
Genomic Location:
Chromosome 15 (position 1098650)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCTCTAATGAGCRTTACTTTGTGCACGCTAATGGGTCTCTKGWTATA[C/T]GAAATGTTAAATTATCTGATGCTGGGGAGTATGTCTGCATGGCTCGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113091 Nonsense 2423 2497 6 6
Genomic Location:
Chromosome 15 (position 1099697)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGCCACCTCCGGCTTTGAAAGGAGTGACGGGAGTTCCTGTTCATCTG[C/T]AGTGTGTTGCTAATGGTATACCTACACCAGATATAGTCTGGGAGCTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113091 Nonsense 2467 2497 6 6
Genomic Location:
Chromosome 15 (position 1099829)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAACCTGTCGGCAGTGAGCTTCTCCAAGCACAAGGGACACTTATAATT[C/T]GAAATCCTACAAGAATGCATTCTGGGAATTACAAGTGTATCGCCTTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9744
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113091 Nonsense 2479 2497 6 6
ENSDART00000113091 Nonsense 2479 2497 6 6
Genomic Location:
Chromosome 15 (position 1099867)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTTMTMATTCGAAATCCTACAAGAATGCATTCTGGGAWTTACAAGTG[T/A]ATCGCCTTTAATTACCTGGRCAGAGATACCAGAACAACATACATGACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18534
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113091 Nonsense 2479 2497 6 6
ENSDART00000113091 Nonsense 2479 2497 6 6
Genomic Location:
Chromosome 15 (position 1099867)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTTMTMATTCGAAATCCTWCAAGAATGCATTCTGGGAWTTACAAGTG[T/A]ATCGCCTTTAATTACCTGGRCAGAGATACCAGAACAACATACATGACAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/upzjo7ua