ptpn9

Ensembl ID:
ENSDARG00000077495
Human Orthologue:
PTPN9
Human Description:
protein tyrosine phosphatase, non-receptor type 9 [Source:HGNC Symbol;Acc:9661]
Mouse Orthologue:
Ptpn9
Mouse Description:
protein tyrosine phosphatase, non-receptor type 9 Gene [Source:MGI Symbol;Acc:MGI:1928376]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32512 Nonsense Available for shipment Available now
sa44229 Nonsense Mutation detected in F1 DNA During 2017
sa15211 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32512
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110389 Nonsense 215 571 7 13
Genomic Location (Zv9):
Chromosome 25 (position 6765084)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 6284526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCATGATCTTCTTTTCAGGTTCAAATGGTGAAGATGGCCGATCTGCGA[C/T]AGCATCTGCCCAGAGATTGTTTACCCGAACACCTTGGCGGCTGTTTGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110389 Nonsense 531 571 13 13
Genomic Location (Zv9):
Chromosome 25 (position 6757827)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 6277269
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACATCTGCCTGTCGCAGCTGCAGGACGTCGGGACGCTTAACATTTGC[C/T]AGACGGTCCGGCGAATGAGATCACAGCGTGCCTTCAGCATACAAACACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15211
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110389 Nonsense 549 571 13 13
Genomic Location (Zv9):
Chromosome 25 (position 6757773)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 6277215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTCCGGCGAATGAGATCACAGCGTGCCTTCAGCATWCAAACACCCGAG[C/T]AGTACTACTTCTGCCACRCCGCCATCCTCGAGCACGCTCAGAGACAGGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link